Biology, 16.04.2020 23:14, cpcoolestkid4

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this sequence might be within the coding region of a gene, you examine it for open reading frames. How many open reading frames exist that go all the way through this DNA fragment? (Recall that the stop codons are 5' TAA, 5' TAG, and 5' TGA.)

Answers: 3

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 01:30, ineedhelp2285

Deer cave cannot support photosynthesis is as not enough sunlight is present. in spite of this, it still has a complex food chain. what is the energy foundation of this food chain?

Answers: 1

continue

Biology, 22.06.2019 04:00, AbbypiePink4942

Food contains a sugar called ( ), which is broken down in a process called cellular ( ). this process uses ( ) to break down food molecules and provide energy for cells. fill in the parentheses

Answers: 2

continue

Biology, 22.06.2019 05:30, ddavid9361

Which of the following produces carbon dioxide? a. plants b. animals c. decomposers d. all of the above

Answers: 1

continue

Biology, 22.06.2019 14:00, treavonknorton

Vinegar has a ph of 3, and household ammonia has a ph of 11. is the concentration of h+ greatest in the vinegar or ammonia?

Answers: 1

continue

Do you know the correct answer?

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small...