PLEASE HELP (WORTH 50 POINTS)

The middle of an mRNA molecule contains the nucleotide
sequence shown here. Much more of the mRNA is translated.
Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
Construct an Explanation Based only on the information provided, why could the mRNA
section be translated into three different sets of amino acids, instead of just one set?

We want most cells to be even in and out which is called

What are some aquatic organisms that live in cold water temperatures?

You have been asked to lead a demonstration for the undergraduate microbiology lab course about the uses of negative staining when studying bacteria. a "negative" stain does not stain the bacterial cell itself but stains the space between cells. under magnification, the acidic (negativelycharged) nature of the stain will be repelled by the negatively charged bacterial cell wall and willleave the cell colorless in a stained background. negative stains are used primarily to reveal the presence of negatively charged bacterial capsules; therefore, they are also called capsule stains. encapsulated cells appear to have a halo surrounding them. the negative stain procedure does not require heat fixation, which limits any chances of alteration in bacterial cell shape and size. the bacterial suspension is added to a drop of stain, such as nigrosin or eosin, and drawn across the glass slide using a coverslip. nigrosin staining-not safranin staining-of klebsiella pneumoniae will allow for the visualization of the cell shape and the determination of the presence of a capsule. true/false