Biology
Biology, 13.04.2020 03:36, LuluMathLover101

If a person with a blood type A had a type o parent, what must the person's genotuype be?

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 22.06.2019 06:50, wildfox479
What is the period of cell life when it is conducting
Answers: 2
image
Biology, 22.06.2019 09:10, dmarte11092001
Explain the cellular functions that occur when antibiotics attack a bacteria cell. a. antibiotics target the cell wall, cell membrane, and the processes of protein and nucleic acids production in bacteria to rupture the cell. b. antibiotics create dormant resistant endospores to preserve the genetic material and rupture the cell. c. antibiotics target the cell wall and form a bridge-like connection to form conjugation. d. antibiotics use binary fission to grow twice its size, replications its dna, and split into two cells.
Answers: 2
image
Biology, 22.06.2019 11:30, smartie80
About how many years does it take for one cycle of surface water to become deep water and then surface water again in the oceans? 101001,000
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
If a person with a blood type A had a type o parent, what must the person's genotuype be?...

Questions in other subjects:

Konu
Mathematics, 23.10.2020 19:40