![Biology](/tpl/images/cats/biologiya.png)
Biology, 10.04.2020 23:47, negativechill
Identify the choice that best completes the statement or answers the question. Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA… To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?a. Calculate the frequencies of each letter.
b. Count the number of letters in the list.
c. Separate the list into three-letter "words."
d. Separate the list into two-, three- and four-letter "words."
![answer](/tpl/images/cats/otvet.png)
Answers: 2
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:00, doris8051
What was the purpose of mendel's experiments with dihybrid crosses? a. to determine if dna was a transforming factor b. to determine if traits could be recessive c. to determine if traits affected each other d. to determine if traits had more than one allele
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, JohnnyR7057
Animals that have thick fur and ae able to store large amounts of body fat live where ?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Do you know the correct answer?
Identify the choice that best completes the statement or answers the question. Robert is studying a...
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mkx.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 20.03.2021 21:30
![Konu](/tpl/images/cats/en.png)
English, 20.03.2021 21:30
![Konu](/tpl/images/cats/ekonomika.png)
Business, 20.03.2021 21:30
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/biologiya.png)
![Konu](/tpl/images/cats/en.png)