Identify the choice that best completes the statement or answers the question. Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA… To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?a. Calculate the frequencies of each letter.
b. Count the number of letters in the list.
c. Separate the list into three-letter "words."
d. Separate the list into two-, three- and four-letter "words."

hi, natural selection of the peppered moth during the industrial revolution in 19th-century england is an example of an outlier in the study of evolution. during this time, pollution from factories filled the forests, coating trees in a layer of soot—turning white trees black

mark as brainlest

gokuson

answer:

the water molecules are transferred from the roots to the stem or top parts of the tall tree because of important properties of water which are adhesion, cohesion and capillary action. cohesion is the property of water molecules keeps water molecules in a combined state by sharing of bonds between them at the atomic level. adhesion allows the interaction of water molecules with other substances or substrate. adhesion will cause the attachment of water molecules to the wall of the vessel (xylem) of the plant. capillary action occurs when the adhesive force to the vessel wall is stronger than the cohesive force between water molecules. capillary action mimics the transfer of water from a tube or pipe. in this way water utilizes its property to transfer water from down to top level of the plant.  

when you breathe in, or inhale, your diaphragm contracts (tightens) and moves downward. this increases the space in your chest cavity, into which your lungs expand. the intercostal muscles between your ribs also enlarge the chest cavity. they contract to pull your rib cage both upward and outward when you inhale.