The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.

How does science influence the decisions made about social, economic, and political issues?

What is the best conclusion based on this data? the hypothesis was not supported because the data indicated that fertilizing plants does not improve plant growth. the hypothesis was supported; to get the best growth, use 5 milliliters of fertilizer per plant. the hypothesis was not supported; the data indicated that too much fertilizer can inhibit plant growth. the hypothesis was supported; to get the best growth, use 15 milliliters of fertilizer per plant.

This is a scaffolding of protein fibers that us sell keep it shape in a cell division and cell movement