Biology
Biology, 26.03.2020 17:37, joeljuarez128oyusun

Which set of terms best describes a community of fishers who live on a bayou in southern Louisiana and use specialized and use specialized boating equipment ?

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 22.06.2019 00:00, eylinglez3ovm16v
Will someone me with this.. specialized cells which perform a particular function form: tissues organs or organism
Answers: 2
image
Biology, 22.06.2019 08:50, donnafranks2003
Blood stem cells may develop into any kind of human blood cells. what kind of stem cells are blood stem cells? a. multipotent stem cells o b. totipotent stem cells o c. pluripotent stem cells o d. unipotent stem cells
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 12:00, luv4appleallday
The embryos of a bird, a reptile, and a mammal are similar in appearance. how does comparing the physical appearance of embryos of different species support the theory of evolution? a. it shows that these organisms share a common ancestor. b. it provides evidence that these organisms eat the same foods. c. it shows that these organisms share the same habitat. d. it provides evidence that these organisms suffered a genetic mutation.
Answers: 1
Do you know the correct answer?
Which set of terms best describes a community of fishers who live on a bayou in southern Louisiana a...

Questions in other subjects:

Konu
Mathematics, 24.01.2022 23:10
Konu
Mathematics, 24.01.2022 23:10