Biology
Biology, 24.03.2020 23:44, evan67

Why is photosynthesis also important for people and animals?

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 22:00, sabrinarasull1pe6s61
Match each description to the appropriate biome. tropical savanna desert tropical rain forest taiga tundra has sparse vegetation and very cold temperatures located near the equator and contains trees that form dense canopy layers is very hot and dry, and has plants that need little water has cold winters, heavy snowfall and is dominated by conifers has warm temperatures and is dominated by grasses
Answers: 1
image
Biology, 22.06.2019 03:00, keke0529
1. watermelon, papaya, oranges, bananas, and lemons are included in this food group. vitamin c 2. you need 6 or more servings of this food group each day vitamins d and a 3. found in fruit and keeps blood vessels healthy calcium 4. vitamins found in milk bread and grain 5. a mineral that strengthens bones fruit
Answers: 3
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:00, mari530
Is this mrna or rna need need the answer in a hurry
Answers: 1
Do you know the correct answer?
Why is photosynthesis also important for people and animals?...

Questions in other subjects: