Biology
Biology, 20.03.2020 23:02, annamcveigh50

Which of the following is (are) correct statements regarding vitamin C?
a. Large doses of the vitamin are not as well absorbed as smaller doses.
b. Most animals can make this vitamin and it is only essential for humans and a few other species.
c. All healthy adults require between 75-90 mg/day
d. All of the above Both B and C are correct

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 00:00, donmak4015
As a small change in a person's dna can cause a genetic disorder
Answers: 1
image
Biology, 22.06.2019 04:40, blakemtyy
Iwill mark brainliest and all that sha-bang. what is the function of the endocrine system? a. control longer term response in the body. b. transmit messages throughout the body. c. remove waste from the body. d. all of the above
Answers: 2
image
Biology, 22.06.2019 10:00, kiki9555
Speed is the ratio of the distance of an object moves to
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Which of the following is (are) correct statements regarding vitamin C?
a. Large doses of the...

Questions in other subjects: