Ribosomes provide the scaffolding on which tRNAs interact with mRNA during translation of an mRNA sequence to a chain of amino acids. A ribosome has three binding sites, each of which has a distinct function in the tRNA-mRNA interactions.
Drag the appropriate tRNAs to the binding sites on the ribosome to show the configurationimmediately beforea new peptide bond forms. Note that one of the binding sites should be left empty.

Choose the molecule that is described by each phrase. energy used during long activities:

What is the key to the recognition of codominance?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?