Given that the sequence of nucleotides in a DNA strand will be used to produce an mRNA strand that will then code for a protein, mutations in the DNA can affect the final product. Depending on the severity of the mutation, the protein can range from not being affected to being rendered completely nonfunctional, especially if the reading frame is altered. Which of the following represents a change in reading frame if the template strand of DNA reads as follows?
A) AGCTGGACTTTAGACAAG
B) AGCTGGACTTTAGACAAG
C) AGCTGGACTTGAGTGAACAAG
D) AGCTGGACTATAGACAAG
E) AGCUGGACUUUAGACAAG
F) AGCTGCGACTTTAGACAAG

AGCTGCGACTTTAGACAAG

Explanation:

The response is AGCTGCGACTTTAGACAAG because this mutation has a number of nucleotides that is not multiple of three bases for codon, which is required for the synthesis of amino acids. In consequence, this mutation will change the reading frame in which ribosome reads the sequence of the mRNA

cell regulation is conducted by special proteins.

i believe the correct answer is the virus gets an envelope that contains host molecules when it leaves the host cell.

explanation:

during the bidding/release stage of a virus, it encapsulates itself with part of the membrane of the host cells in this case the cells of the monkey and is the reason as to why the scientist found the genetic material of the monkey on the viral cell surface.

further explanation

to understand this answer, we have to know the cycle a virus undergoes to replicate. a virus is basically a bunch of genetic material enclosed in a capsule and lacks any machinery or organelles to ensure their survival so they must enter a host cell in order to get the environment needed to survive. some viruses enter and lyse(destroy) the host cell after they have replicated and undergo the lytic cycle while some enter and leave the cell intact after replicating and these undergo a lysogenic cycle. to enter the cell, they undergo the first process called attachment by binding to specific receptors and co-receptors on the surface of the host cell. after attaching to the cell, they start the second phase called penetration where virus enters or is engulfed whole by the host cell through a process called endocytosis. it is the same process that a cell takes up materials it needs or pathogens around it. uncoating of the virus then happens after the virus has been engulfed and is the third stage. the virus then undergoes releasing of its genetic material in the host's matrix.   the materials then enter the nucleus and undergo biosynthesis by adding themselves in strands of rna being translated and then copies of the virus are produced in addition to the host genetic material. the material/newly formed viral material then undergoes assembly inside the host cell and form a capsule around them. the virus undergoes the last release/budding stage by binding to the host membrane and pushing outwards. in doing so when they tear away from the host membrane, they pick up the genetic material from the membrane of the host cell to form their envelope.

learn more:

1.

2.

3.

level: high school