Biology
Biology, 09.03.2020 21:57, wtwbegay

A sixth gene, jv, was tested against h and th. You obtain the following percentage of recombinant offspring:

jv- h jv-th
7.3% 24.0%

Based on this information, where is jv located on the map you constructed?

a. between th and cu
b. between rai and h
c. between h and eyg
d. between eyg and th

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 20:30, jackson5637
Glands that the body deal with stress and respond to emergencies.
Answers: 1
image
Biology, 22.06.2019 21:00, kelo251
Which methods are the most common for dealing with waste
Answers: 1
image
Biology, 22.06.2019 22:30, jisalinas5576
Water changes bacteria in the soil converts this nutrient into a usable form. plants take up the usable nutrient through the soil and assimilate it into proteins, making it part of the plant. an animal eats the plants, and the nutrient becomes part of the animal. when the animal dies, it decomposes, returning the nutrient back to the soil. which cycle is being described? water cycle carbon cycle nitrogen cycle phosphorous cycle
Answers: 1
Do you know the correct answer?
A sixth gene, jv, was tested against h and th. You obtain the following percentage of recombinant of...

Questions in other subjects:

Konu
Mathematics, 22.10.2020 17:01