Indicate whether each of the following descriptions better matches miRNAs (M) orsiRNAs (S) in animal cells. Your answer would be a four-letter string composed of letters M andS only, e. g. .(a) They usually cleave their target RNAs using the slicing activity of the Argonautes.(b) They typically show perfect complementarity with their target RNA.(c)They can bind to the RITS as well as the RISC complex.(d) They seem to be the more ancient form of small noncoding RNAs.

What maintain homeostasis when a persons internal body temperature is 97.5°f

About __ of the mass of the cell is water

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?