Biology
Biology, 24.02.2020 19:02, Blaise2653

The human spine acts like a weight-bearing column. Compare this to the spine of a horse, which acts like an elastic suspension bridge. Which organism would you predict to experience more back pain and why?

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 21.06.2019 17:50, hectorgonzalejr333
Which best describes red blood cells? a. they are colorless b. they protect against disease-carrying microorganisms c. they transport oxygen throughout the body d. they aid in blood clotting
Answers: 1
image
Biology, 22.06.2019 11:00, airrish
What factors contribute to the effect an environmental toxin has on the human body?
Answers: 3
image
Biology, 22.06.2019 11:30, kmchippps
According to theories of how life began, how did early organic molecules begin to separate from the outside world? a: specialized enzymes were required b: chains of amino acids created a barrier c: formation of microspheres or vesicles d: rna catalyzed the formation of membranes
Answers: 3
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
The human spine acts like a weight-bearing column. Compare this to the spine of a horse, which acts...

Questions in other subjects:

Konu
Mathematics, 17.09.2020 14:01
Konu
Mathematics, 17.09.2020 14:01
Konu
Mathematics, 17.09.2020 14:01
Konu
Mathematics, 17.09.2020 14:01
Konu
Mathematics, 17.09.2020 14:01
Konu
Social Studies, 17.09.2020 14:01
Konu
Mathematics, 17.09.2020 14:01
Konu
Mathematics, 17.09.2020 14:01
Konu
Social Studies, 17.09.2020 14:01
Konu
English, 17.09.2020 14:01