Biology
Biology, 18.02.2020 19:52, isabelperez063

Which of the following is true?

A) Some substances must be dissolved in water before they can be used.

B) Water is important to some organisms.

C) All organisms obtain water through food.

D) Plant cells are unaffected when water is scarce.

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 21.06.2019 23:30, itsdria
Aboy with an extra x chromosome probably has which of the following syndromes?
Answers: 1
image
Biology, 22.06.2019 10:00, FailingstudentXD
Dna and rna share a number of similarities, but they also differ in certain aspects of their structure. wich nitrogenous base is found in rna but is not found in dna
Answers: 1
image
Biology, 22.06.2019 10:00, kiki9555
Speed is the ratio of the distance of an object moves to
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Which of the following is true?

A) Some substances must be dissolved in water before the...

Questions in other subjects: