Biology, 10.02.2020 02:05, ykpwincess
PLEASE HELP!
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine the DNA segments from two different species:
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Be sure to answer this question in paragraph form using complete sentences.
Answers: 1
Biology, 22.06.2019 02:30, ComicSans10
Sally and sue were investigating the topic of friction in science. they used a small car and a ramp as seen in the picture to test what they were learning. they knew that they slipped easily on waxed floors but not on carpet, so they decided to change the material on the surface of the ramp to see what happened. they planned to use glass, carpet, aluminum foil, and sandpaper and run the car down the ramp over each surface. what would be the best research question to guide the girls' experiment? a) does the amount of surface area affect the friction on the moving car? b) will the car travel fastest on the glass surface? c) how does the angle of the ramp affect the speed of the car? d)do rougher surfaces tend to create more friction than smooth surfaces?
Answers: 1
Biology, 22.06.2019 08:00, friskisthebest1
As the pea seeds respire, the level of coloured liquid in the left hand part of the capillary tube rises. by referring to what is happening in the apparatus, explain why the level of liquid changes
Answers: 3
Biology, 22.06.2019 14:20, strevino9178
When a population split into two subgroups what is most likely to cause the subgroups to develop different traits?
Answers: 1
Biology, 22.06.2019 17:10, codyshs160
Organisms may contain up to five levels of organization within their bodies. which level of organization is shown by the liver? a. tissue b. organ c. organism d. organ system
Answers: 1
PLEASE HELP!
A certain segment of DNA can be used as a molecular clock. Its rate of mutation i...
A certain segment of DNA can be used as a molecular clock. Its rate of mutation i...
Business, 05.10.2019 08:30
History, 05.10.2019 08:30
Mathematics, 05.10.2019 08:30
Mathematics, 05.10.2019 08:30
Biology, 05.10.2019 08:30
Mathematics, 05.10.2019 08:30