Science !

the diagram shows one step in the process of protein synthesis. t he process shown in the diagram is called

< < i think it's protein synthesis? that might make sense with the rest of the question? i just need a lil refresher (no guessing pls)
.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Which of these is one of the nitrogenous bases in dna? a. proline b. leucine c. glycine d. thymine

An uncomfortable feeling in the ears when descending in an airplane is caused by changes in air pressure on the: a. inner ear b. middle ear c. eardrum d. hammer/anvil