![Biology](/tpl/images/cats/biologiya.png)
Adefect in the absorption of certain nutrients in the small intestine has been linked to an abnormally-delayed initiation of differentiation. if the levels of her2, pten, and akt protein can be estimated accurately, what is the earliest point in development at which the defect could be evaluated? a. 14 weeks b. 16 weeks c. 20 weeks d. 24 weeks
![answer](/tpl/images/cats/otvet.png)
Answers: 3
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:00, genesisramirezozfyj7
What molecules will be best used to compare different species with the exact same sequence of amino acids? why would two species have the same protein even if the molecules in question is different? (hint: transcription to translation to protein).
Answers: 1
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 22:30, patrickfutrell2537
Alaboratory investigation included examine prepared slides of pond water singled celled organisms with a nucleus and either cilia or flagella were visible these organism probably belong to the kingdom
Answers: 3
Do you know the correct answer?
Adefect in the absorption of certain nutrients in the small intestine has been linked to an abnormal...
Questions in other subjects:
![Konu](/tpl/images/cats/himiya.png)
![Konu](/tpl/images/cats/es.png)
Spanish, 03.09.2020 03:01
![Konu](/tpl/images/cats/informatica.png)
Computers and Technology, 03.09.2020 03:01
![Konu](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 03.09.2020 03:01
![Konu](/tpl/images/cats/ekonomika.png)
![Konu](/tpl/images/cats/biologiya.png)
Biology, 03.09.2020 03:01
![Konu](/tpl/images/cats/mat.png)
Mathematics, 03.09.2020 03:01
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 03.09.2020 03:01