Assume that there is a gene in apples that determines fruit color and a second gene that determines fruit size. let a represent the dominant allele for big apples, and a represent the recessive allele for small apples. similarly, let r represent the dominant allele for red apples, and r represent the recessive allele for yellow apples. you have one tree that produces big yellow apples and another tree that produces small red apples. when the two are crossed, you find that half of the new trees produce big red apples and half produce big yellow apples. what are the genotypes of the parents?

Consider the skeleton. which skeletal system is represented by the shaded portion of the skeleton? spongy skeleton compact skeleton axial skeleton appendicular skeleton

Pls quickly! which of the following is true about the behavior of an organism? a. the behavior of an organism is influenced by both its heredity and it’s environment. b. the behavior of an organism is influenced only by the treats it inherits from its parents. c. the behavior of an organism is influenced only by the environment in which it lives in. d. the behavior of an organism is not influenced by either it’s heredity or its environment.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?