Biology, 03.12.2019 07:31, pineappledogpie1608

True / false: the peripheral receptors located under the skin are very sensitive to to temperature changes and only provide feedback on to the hypothalamus (select one word answer only ).

Answers: 3

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 06:30, nacgrading3p6d8pf

1. describe the structure and function of the specialized cells you observed in the video. 2. research the types of cells present in the kidney.

Answers: 1

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

Biology, 22.06.2019 14:30, joejoefofana

Which of the following shows the results that you would get if you tested beef using the four tests in the gizmo

Answers: 1

continue

Biology, 22.06.2019 16:30, leannesmith90101

You will create a molecular clock model for an arthropod gene. follow these guidelines to make your model: . your timeline will span from 90 million years ago to the present. the common ancestor in your model is an arthropod that lived 90 million years ago. the gene that you'll track codes for a protein in the species venom . the dna sequence youll track contains 10 nitrogen bases. you can choose the order of the bases and where the mutations occur. this gene mutates at a rate of approximately 0.76 base pairs every 17.1 million years. to build your model,/ calculate the estimated time period it takes for 1 base pair to mutate. the first time period will only show the common ancestor. at the beginning of the second time period, three lineages will diverge from the common ancestor, each with a different mutation in their gene sequences. the first and third descendant species will survive for the rest of the timeline. the second descendant species was extinct 50 million years ago. calculate how long it will take for one full base pair mutation to occur. explain your reasoning by constructing a mathematical equation

Answers: 2

continue

Do you know the correct answer?

True / false: the peripheral receptors located under the skin are very sensitive to to temperature...