Biology, 26.11.2019 05:31, carlosbs71

You performed a sanger sequencing reaction and obtained the following electropherogram (a computer-generated trace of the intensity of each color's fluorescence). in this figure, a = green, c = purple, g = black, t = red. the height of the peaks is unimportant. the 5' end of the sequence is at the left of the trace.

what is the sequence of the template dna used for this sequencing reaction?

a.

5' tttgctttgtgagcggataacaa 3'

b.

3' tttgctttgtgagcggataacaa 5'

c.

5' aaacgaaacactcgcctattgtt 3'

d.

5’ ttgttatccgctcacaaagcaaa 3’

e.

3' aaacgaaacactcgcctattgtt 5'

can someone with this? i can never get more than 3/5 right:

match the following terms with their descriptions below.

question selected match
used to detect close or exact complementarity to a probe sequence

c.
high stringency

used in identifying a specific mrna from a mixture

a.
northern blot

used to quantitate the initial template concentration of an unknown relative to a standard template of known concentration

b.
template dna

reliant upon dna mismatch repair

d.
site-directed mutagenesis

refers to the sequence of interest within the sample in a pcr reaction

e.
cycle threshold method (ct)

Answers: 1

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 23:30, iwantcandy2002

Considering the yellow and green pea color phenotypes studied by gregor mendel: a. what is the biochemical function of the protein that is specified by the gene responsible for the pea color phenotype? (1 point) b. a null allele of a gene is an allele that does not specify (or encode) any of the biochemical function that the gene normally provides (in other words, either no protein at all or only non-functional protein is produced from it). of the two alleles, y and y, which is more likely to be a null allele? (1 point) c. in terms of the underlying biochemistry, why is the y allele dominant to the y allele? (2 points) d. why are peas that are yy homozygotes green? (1 point) e. the amount of protein produced from a gene is roughly proportional to the number of functional copies of the gene carried by a cell or individual. what do the phenotypes of yy homozygotes, yy heterozygotes, and yy homozygotes tell us about the amount of sgr enzyme needed to produce a yellow color? explain your reasoning. (2 points)

Answers: 1

continue

Biology, 22.06.2019 05:00, shaheedbrown06

Which statements about the fluid mosaic structure of a membrane are correct? select the three correct statements. which statements about the fluid mosaic structure of a membrane are correct? select the three correct statements. the framework of a membrane is a bilayer of phospholipids with their hydrophilic heads facing the aqueous environment inside and outside of the cell and their hydrophobic tails clustered in the center. because membranes are fluid, membrane proteins and phospholipids can drift about in the membrane. the diverse proteins found in and attached to membranes perform many important functions. the kinky tails of some proteins keep the membrane fluid by preventing the component molecules from packing solidly together. membranes include a mosaic, or mix, of carbohydrates embedded in a phospholipid bilayer.

Answers: 1

continue

Biology, 22.06.2019 13:20, abolton04

Imagine a self-reactive t cell that has not undergone clonal deletion in the thymus (that is to say, it has escaped central tolerance). if it encounters self antigen in the absence of an infection or inflammation, what will happen to this self-reactive t cell? (select two answers) (a) the t cell undergoes clonal expansion. (b) the t cell gains effector functions. (c) the t cell undergoes apoptosis. (d) the t cell becomes activated. (e) the t cell becomes anergic.

Answers: 1

continue

Biology, 22.06.2019 13:20, danidavis2002

Which cell organelle is the site for photosynthesis? a. chloroplast b. endoplasmic reticulum c. golgi apparatus d. lysosome

Answers: 1

continue

Do you know the correct answer?

You performed a sanger sequencing reaction and obtained the following electropherogram (a computer-g...