Protein synthesis and mutation cer practice
what is the type of mutation that has occurred in this sequence and its
significance?
original dna sequence: ctgcacctgactcctgaggag
mutated dna sequence: ctgcacctgactcctgggag
claim:

there is no stairs in bungalow

explanation:

poof

helicase, i think thats it

the limb fractures are among the most common fractures. open fractures are comparatively more dangerous. the injury patterns are dependent on many factors, such as the age of the person, and mechanism of the injury. the closed fractures of the limbs if left untreated may lead to a significant amount of the blood loss, which may be life-threatening for the person. approximately 1000-1500 ml of blood is lost in the close fracture of the femur, and 500-1000 ml of blood is lost in the closed fracture of lower part of the limbs.

i think i can answer even without the example. over time with environmental changes, sometimes a group of animals will adapt to better survive. take a moth for example. if the trees the moths use to camouflage themselves from predators, started to die or change colors themselves, the moths may, overtime of course, change color too. its just adapting to its surroundings. hope i was of any : )