![Biology](/tpl/images/cats/biologiya.png)
Biology, 28.10.2019 20:31, yeomans410
Members of phylum porifera are unique among animals because they contain __ distinct tissue layers.
![answer](/tpl/images/cats/otvet.png)
Answers: 1
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:30, carolinerosewillis
One of the reasons that stars are so large is because
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, swaggernas
Abody cell has been growing and at synthesis proteins. in the nucleus of this body cell, dna replication is taking place. and a copy of the cells genetic material is copied. which of the following is the best conclusion you can make about the life cycle of this cell ? a) the cell is ready to undergo mitosis. and a chemical signal will send the cell to prophase b)the cell is undergoing meiosis and will cross over the genetic material next c)the cell is in the s phase of interphase and will move next to the g2 phase d) the cell is in the g2 phase of the interphase and is ready to begin diving
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 14:50, megamorph
Lactase is essential for digesting lactose in milk. this enzyme is specific for this sugar. why? molecules and active sites vary in size; only properly sized molecules can fit. there is a precise compatibility between the active site and the lactose molecule. specificity refers to the action of the enzyme, such as hydrolysis, and relatively few molecules can be hydrolyzed. reaction-specific enzymes assume a fit by folding around the most numerous substrate molecules.
Answers: 1
Do you know the correct answer?
Members of phylum porifera are unique among animals because they contain __ distinct tissue layers....
Questions in other subjects:
![Konu](/tpl/images/cats/en.png)
English, 25.06.2019 12:50
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 25.06.2019 12:50
![Konu](/tpl/images/cats/mat.png)
Mathematics, 25.06.2019 12:50
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 25.06.2019 12:50
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/ekonomika.png)
Business, 25.06.2019 12:50