Dna replication, transcription, & translation (10 points)
1. provide the (a) dna strand and (b) mrna strand that would be produce from the
following dna template: gctaccgactcgactgcactt
a. dna strand:
b. mrna strand:
2. what enzyme(s) is adding nucleotides to the template dna strand during (a) dna replication
and (b) transcription
a. dna replication:
b. transcription:
3. use the mrna strand from question 1 to translate into a series of proteins. use the
codon chart attached and fill out the chart below.