The concept of a hertiable molecule (that we now know is dna) between cells
a. began in the 8...
![Biology](/tpl/images/cats/biologiya.png)
Biology, 17.10.2019 01:20, djdkfkfkckmfmf7724
The concept of a hertiable molecule (that we now know is dna) between cells
a. began in the 80s when we could copy dna
b. had long been theorized before it could be demonstrated
c. occurred in the 1920s
d. occurred in the 1940s
![answer](/tpl/images/cats/otvet.png)
Answers: 1
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 01:30, eguilford4438
Scenario 5 1) take 10 red and 10 black beans and place them, mixed, on the table. record the starting phenotype # and frequencies (% of your total population) of your starting population in the table provided (generation 0). 2) act as a predator. “capture” as many organisms as you can until you have reduced the population to three organisms. put them aside. at this point, the predators die. 3) the remaining organisms each produce 2 clonal offspring. multiply your organisms accordingly and allow them to mix on the table. calculate and record the resultant phenotype # and frequencies (% of your total population) of your population in the table provided (generation 1). 4) repeat the reproduction event, allowing each of your organisms to produce 2 clonal offspring. calculate and record the resultant phenotype # and frequencies (% of your total population) of your population in the table provided (generation 2). 5) repeat the reproduction event, allowing each of your organisms to produce 2 clonal offspring. calculate and record the resultant phenotype # and frequencies (% of your total population) of your population in the table provided (generation 3).
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:30, caliharris123
What is the correct answer for the process of water eroding soil? rills, sheet erosion, gullies sheet erosion, rill, gullies gullies, rills, sheet erosion sheet erosion, gullies, rills
Answers: 1
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
Mathematics, 02.05.2021 06:30
![Konu](/tpl/images/cats/mkx.png)
Arts, 02.05.2021 06:30
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/ap.png)
Advanced Placement (AP), 02.05.2021 06:30
![Konu](/tpl/images/cats/mat.png)
Mathematics, 02.05.2021 06:30
![Konu](/tpl/images/cats/mat.png)
Mathematics, 02.05.2021 06:30
![Konu](/tpl/images/cats/mat.png)
Mathematics, 02.05.2021 06:30
![Konu](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 02.05.2021 06:30
![Konu](/tpl/images/cats/pravo.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 02.05.2021 06:30