What are pros and cons of robotics and living test subjects?

Which best describes how the common cold spreads in the human body? a bacteria burst out of normal cells killing them b viruses replicate inside respiratory cells c bacteria inject dna into normal cells d viruses insert dna into bacteria

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

9. technology can bring both good and bad things. building a vertical farm can increase food supplies in cities (good), but it may cause unemployment in rural areas (bad). give another example of both the good and bad sides of a technological advancement (5 noints)