Fill in the blank to complete each statement regarding processes that shape earth’s surface landscape.
? is the process of sediment being placed in a new location.
when sediment is carried away, this process is called ?

Restriction enzymes are used in making recombinant dna. describe the role restriction enzymes perform when constructing recombinant dna.

Match the following terms and definitions. 1. species that are adapted to live in equilibrium at carrying capacity population density 2. population growth that reaches equilibrium and carrying capacity population 3. death rate mortality 4. birth rate k-selected 5. a group of interacting individuals of the same species within the same geographic area natality 6. the number of organisms living in a particular area logistic growth

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?