Which statement correctly compares nucleic acids and carbohydrates? they both contain phosphorus, but only nucleic acids contain hydrogen. they both contain carbon, hydrogen, and oxygen in a 1: 2: 1 ratio. they both contain carbon, but only carbohydrates contain oxygen. they both contain carbon, but only nucleic acids contain phosphorous.

What molecule contains an organisms genetic material, passed down from parents to their offspring

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Is this mrna or rna need need the answer in a hurry