Biology, 24.07.2019 11:40, nanamath5662
Purple sea stars are found in the pacific ocean. they prey on common mussels, suppressing the mussel population in the intertidal zone of the pacific northwest. by controlling the mussel population, sea stars enable the ecosystem to support other invertebrates. experimental data suggests that purple sea stars are a keystone species in the intertidal zone of the pacific northwest.
what will most likely happen to this ecosystem if the purple sea star is permanently removed?
Answers: 2
Other questions on the subject: Biology
Biology, 22.06.2019 04:30, donaji1024perez
Taq polymerase is an enzyme isolated from the organism thermophilus aquaticus. this organism has been found living in the hot springs of yellowstone national park. this enzyme is used to copy human dna from crime scenes. most reactions are performed at ranges similar to those of the human body; however, what considerations should be made for optimum use of this enzyme? view available hint(s)taq polymerase is an enzyme isolated from the organism thermophilus aquaticus. this organism has been found living in the hot springs of yellowstone national park. this enzyme is used to copy human dna from crime scenes. most reactions are performed at ranges similar to those of the human body; however, what considerations should be made for optimum use of this enzyme? the enzyme will not work on human dna. nothing should be altered. the ph should be decreased. the temperature should be raised.
Answers: 2
Biology, 22.06.2019 10:00, alexwlodko
Based on the observation that only male crickets produce a song, you hypothesize that a male's song is a form of communication to potential mates. you set up a simple experiment to test this hypothesis. in the laboratory, you place a male snowy tree cricket in enclosure a, which is adjacent to enclosureb. in enclosure b, you place other insects, one at a time, and observe their responses to the male's song. the enclosures are designed so that the two insects being tested cannot see or smell each other, but sound is transmitted from enclosure a to enclosureb.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Purple sea stars are found in the pacific ocean. they prey on common mussels, suppressing the mussel...
Questions in other subjects:
Computers and Technology, 20.11.2020 03:50
Mathematics, 20.11.2020 03:50
Health, 20.11.2020 03:50
