Biology, 23.06.2019 08:00, ericlawton
The somatic cell of a cat contains 38 chromosomes (2n = 38). how many chromosomes and how many dna molecules would the secondary spermatocyte of this cat have?
Answers: 3
Biology, 22.06.2019 10:30, hhcfg
What is the best conclusion based on this data? the hypothesis was not supported because the data indicated that fertilizing plants does not improve plant growth. the hypothesis was supported; to get the best growth, use 5 milliliters of fertilizer per plant. the hypothesis was not supported; the data indicated that too much fertilizer can inhibit plant growth. the hypothesis was supported; to get the best growth, use 15 milliliters of fertilizer per plant.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 17:30, VamPL
Mr. j, age 42, is a construction worker in las vegas. he recently noticed that a mole on his face seemed to be getting larger and darker. at first he did not worry because he was in the sun a lot and assumed the change may have been caused by sunburn. after a month, not only was the mole larger and darker, but it appeared to be “bumpy.” his doctor diagnosed a malignant melanoma skin cancer following biopsy of the nevus. mr. j reports pain in his right shin that does not go away when he puts his feet up or sleeps. discussion questions 1. relate mr. j’s skin changes to the warning signs for malignant melanoma. (see malignant melanoma.) 2. discuss the normal progression of this malignancy. what is the significance of the bone pain that mr. j is experiencing? (see malignant melanoma.) 3. discuss the treatment available for this patient and the prognosis for recovery. (see malignant melanoma.)
Answers: 3
The somatic cell of a cat contains 38 chromosomes (2n = 38). how many chromosomes and how many dna m...
Spanish, 24.02.2021 02:30
English, 24.02.2021 02:30
Mathematics, 24.02.2021 02:30
Law, 24.02.2021 02:30
Chemistry, 24.02.2021 02:30
Mathematics, 24.02.2021 02:30
Mathematics, 24.02.2021 02:30