1. based on the trend depicted in the graph, explain what you think the relationship might be between organisms performing respiration and the organisms performing photosynthesis in this area of the world. 2. what effects might this steady increase of carbon dioxide have on the organisms living in this area? 3. describe the changes you would expect to see to this graph if the population of cyanobacteria increased dramatically in the ocean water surrounding hawaii in 2003. explain your predictions.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:40, milkshakegrande101
Read the article and use the information to answer the questions that follow discovering the structure of dna explain how the discoveries by rosalind franklin watson and crick build an accurate model of dna done
Answers: 2
Biology, 22.06.2019 23:00, lizdominguez101
Need ! will give 20 points! what are two ways that diatoms differ from slime molds? the external coverings of diatoms are made up of (silica, chitin or peptidoglycan), while slime molds have cell walls containing (silica, peptidoglycan or chitin). diatoms are (chemoheterotrophs, photoautotrophs or chemoautotrophs) because they make food through photosynthesis, while slime molds are (heterotrophs, phototrophs or autotrophs) because they eat decaying plant matter.
Answers: 3
1. based on the trend depicted in the graph, explain what you think the relationship might be betwee...
History, 27.03.2020 18:24
World Languages, 27.03.2020 18:24
Physics, 27.03.2020 18:24