Biology, 29.06.2019 17:30, alexius6608
Nitrogenous bases are located on both strands of the dna double helix. what is the significance of the nitrogenous bases?
Answers: 1
Biology, 22.06.2019 01:10, theojw
Determine if the following statement is true or false. if true, choose true. if false, choose the rewording that is true. according to the law of independent assortment, alleles for each gene are inherited together so that they always stay together. according to the law of independent assortment, offspring express a combination of their parents' traits. according to the law of independent assortment, alleles for a characteristic split during meiosis and combine during fertilization. true according to the law of independent assortment, alleles for each gene are inherited independently so that no two alleles stay together.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Nitrogenous bases are located on both strands of the dna double helix. what is the significance of t...
Spanish, 13.06.2021 02:30
Mathematics, 13.06.2021 02:30
Mathematics, 13.06.2021 02:30
History, 13.06.2021 02:30
Computers and Technology, 13.06.2021 02:30