Biology, 02.12.2019 07:31, gabriel345678734
in nature, there is a constant modification of a species' gene pool toward features that enhance survival and reproduction which of the following terms best describes this?
a. selective breeding
b. hybridization
c. taxonomy
d. natural selection
Answers: 3
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:00, florencemarti7331
As a result of these processes the single celled organism accomplishes
Answers: 1
Biology, 22.06.2019 16:20, cobalt3931
What is gene flow? apexa: selection for average traits b: when a population splits in twoc: a mutation becoming more commond: genes moving between two populations
Answers: 1
Biology, 22.06.2019 22:00, iisanchez27
Explain how negative feedback caused the changes in plasma glucagon concentration observed during the experiment.
Answers: 2
in nature, there is a constant modification of a species' gene pool toward features that enhance sur...