Biology
Biology, 04.02.2020 13:49, azolber

Which region of a trna molecule binds to amino acids?

a. anticodon loop
b. codon loop
c. the 3’ end
d. variable loop

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 22.06.2019 02:30, xarianna2007
What does natural resource management aim at ?
Answers: 2
image
Biology, 22.06.2019 11:00, ellieballinger9364
3what is the range of the function shownin the graph? ucation solutionsnw novo-9-8-7 -6 -5 -4 -3 -2 -1123456789
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 12:00, AnimePo2020
What type of graph presents information about how often certain or traits occur?
Answers: 1
Do you know the correct answer?
Which region of a trna molecule binds to amino acids?

a. anticodon loop
b. codon...

Questions in other subjects: