Biology
Biology, 26.12.2019 09:31, jdaballer3009

What are 3 things that all animals with bodies have?

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 21.06.2019 21:00, bshreve
What is a codon and where is it found
Answers: 1
image
Biology, 22.06.2019 02:00, dj129239
Identify the terms using the following picture. principle of dominance item 1 can be described as the . item 2 can be described as the . the "p" represents from one parent.
Answers: 3
image
Biology, 22.06.2019 11:30, alyssahomeworkneeds
Graded assignment lab report answer the questions below. which combinations of substances resulted in a chemical change? for each metal that participated in a chemical change, write the type of metal it is, based on your examination of the periodic table. were there any metallic compounds that did not react with either the acid or the base? write the type of metal, based on your examination of the periodic table. make a general statement about the reactivity of the metals in this experiment.
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
What are 3 things that all animals with bodies have?...

Questions in other subjects: