Biology, 29.09.2019 10:20, babyari18

Which of the following items would be an ecosystem within the ocean ecosystem?
a. marshes
b. coral reefs
c. rivers
d. ponds

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 21:20, zay65307

Atypical human cell is approximately 12.00 μm in diameter and enclosed by a membrane that is 5.000 nm thick. (a) what is the volume of the cell including the membrane? (b) what is the volume of the cell membrane? (c) what percent of the total volume does its membrane occupy? to simplify the calculations, model the cell as a sphere. enter your answers using four significant figures.

Answers: 3

continue

Biology, 22.06.2019 01:50, leslie0296

Which phrase is the best summary of the model shown? a. the transfer of the sun's energy through trophic levels b. a series of aerobic and anaerobic reactions c. a transformation of light energy into chemical energy d. the breakdown of food molecules

Answers: 2

continue

Biology, 22.06.2019 03:30, pineapplefun

The human genome project is devoted to mapping the general dna sequence of our species. this could lead to the development of new medicines, as well as the possibility of using gene therapy to treat certain diseases. however, there are some ethical issues surrounding the mapping of individual genomes. one concern is a) that your genes may change over time, making the project useless. b) that insurance companies could discriminate based on genetic make-up. c) that since this has never been done before, we should probably not do it now. d) that sequencing our individual genomes is so expensive, it is a counter-productive strategy.

Answers: 1

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

continue

Do you know the correct answer?

Which of the following items would be an ecosystem within the ocean ecosystem?
a. marshes