Fill a glass with water above the rim. it forms a domed surface. add a paper clip and watch it float, even though the paper clip is made of a metal that is denser than water. this is due to water's surface tension. water has several very unique properties, like surface tension, cohesion, and adhesion because water

Which way do the nitrogenous bases in dna pair up? a. a and g; t and c b. a and c; t and g c. a and t; g and c d. a and a; t and t; g and g; c and c

Which of the following does not make up ground substance of connective tissue? hyaluronic acid elastic fibers glycosaminoglycan proteoglycan

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?