Biology, 01.07.2019 12:30, serenity6282
Who built the first microscope which allowed people to see things no one has ever seen before such as bacteria sperm in red blood cells
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:30, CarleySamuel
Where is most of the fresh water on earth found a in the ocean b in glaciers and in ice caps c in rivers d in the soil
Answers: 1
Biology, 22.06.2019 20:30, Garciaapril1597
Aspecies has evolved an asexual mode of reproduction by having offspring develop from unfertilized eggs. which of the following will be true of this species' response to natural selection? there will be more deaths from natural selection because there is no mutation. there will be less genetic variation from recombination and a risk of not adapting quickly to environmental change. the species will increase in numbers because genetic variation is increased. the species will compensate for loss of genetic variation by hybridizing with other species. there will be fewer deaths from natural selection because sexual recombination always leads to extinction.
Answers: 1
Who built the first microscope which allowed people to see things no one has ever seen before such a...
English, 22.09.2019 15:00
English, 22.09.2019 15:00
English, 22.09.2019 15:00
Mathematics, 22.09.2019 15:00
Computers and Technology, 22.09.2019 15:00
History, 22.09.2019 15:00