Answers: 1
Biology, 21.06.2019 15:40, mktdonaldson
Aneuron is stimulated with an electric pulse. the action potential is detected at a point 3.70 cm down the axon 0.0052 s later. when the action potential is detected 7.20 cm from the point of stimulation, the time required is 0.0063 s. what is the speed of the electric pulse along the axon? (why are two measurements needed instead of only one? )
Answers: 2
Biology, 22.06.2019 10:30, TH3L0N3W0LF
16. which of the following accurately describes a step within transcription? a. dna polymerase uses one strand of rna as a template to put together nucleotides. b. the dna strand is used as a template for which a complementary rna strand can be produced. c. the rna strand forms a template by which dna can be built. d. the rna strand is produced within the cytoplasm.
Answers: 3
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Acomet is a big block of ice and rock whirling about in ours and other solar systems. t true f false...