Biology

Biology, 18.07.2019 14:00, ryleeshea816

List the nitrogen bases that would form the complementary strand: ttctaccctacatagactcat

answer

Answers: 1

Show answers

Similar questions

Предмет

Biology, 19.07.2019 00:20, kingoc321

Plz will also give brainliest 1.what is dna? why is it important to every living thing? 2.what two substances make the backbone of the dna molecule? 3.are the backbones of the dna molecule identical in all living things? 4.are the base pairs always the same? 5.if there were five guanine bases in one strand of your model of dna, how many cytosine bases would there be in the complementary strand? 6.if there were 10 bases of thymine in one strand of your model of dna, how many adenine bases would there be in the complementary strand? 7.if the dna molecule is so similar among all living things (the pairings are always the same and that there are only six components that make up dna), why is there so much diversity of life?

Answers: 1

Предмет

Biology, 26.07.2019 02:30, chelsea73

Will give brainliest 4. are the base pairs always the same? 5. if there were five guanine bases in one strand of your model of dna, how many cytosine bases would there be in the complementary strand? 6. if there were 10 bases of thymine in one strand of your model of dna, how many adenine bases would there be in the complementary strand? 7. if the dna molecule is so similar among all living things (the pairings are always the same and that there are only six components that make up dna), why is there so much diversity of life?

Answers: 1

Предмет

Biology, 17.09.2019 21:00, ethangeibel007

Adna molecule consists of two polynucleotide strands that form a double helix. the strands are held together by hydrogen bonds between the nitrogen‑containing bases. one strand is complementary to the other strand, which means that a base on one strand is paired with a base on the opposite strand. the nucleotide bases in dna are adenine (a), cytosine (c), guanine (g), and thymine (t). choose the dna sequence complementary to gact (a) agtc (b) gact (c) tcag(d) ctga

Answers: 2

Предмет

Biology, 19.10.2019 18:30, yurlgurllmay

The following strand of dna is undergoing replication: cgttacat. what is the sequence of bases that will form as the complementary strand?

Answers: 1

Do you know the correct answer?

List the nitrogen bases that would form the complementary strand: ttctaccctacatagactcat...

Questions in other subjects:

Konu

Business, 11.06.2021 19:10

The position in a craft union in which the holder is the chief administrator of the union hiring hall is the...

Konu

Mathematics, 11.06.2021 19:10

For cylinders with radius 2 units, let h represent the height of the cylinder, in units, and the V represent the volume of the cylinder, in cubic units. a. Complete the table rela...

Konu

History, 11.06.2021 19:10

¿Cuando apareció el cristianismo? ...

Konu

Mathematics, 11.06.2021 19:10

HELP ME PLS I NEED HELP ...

Konu

Biology, 11.06.2021 19:10

The part of the heart-lung machine that functions like the right ventricle of the heart is labelled...

Konu

History, 11.06.2021 19:10

What was one good thing that happened in the Chinese exclusion act that modern day should do?...

Konu

Mathematics, 11.06.2021 19:10

I need help I have to match them ...

Konu

Mathematics, 11.06.2021 19:10

I need all of these answered correctly, if you please ^^ This is about percentages, I’m not good with these. 1. “ If 20% of a number is 35, what is 50% of that number...

Konu

Mathematics, 11.06.2021 19:10

Angle PRQ Is isosceles with PR=QR 7x-4, QR= 3x +8, and PQ = 2x+1. Find PQ Please answer...

Konu

Social Studies, 11.06.2021 19:10

is a clinically based approach to treating mental illness that focuses on the unconscious mind as the most powerful force behind thought and behavior....

Other tasks in the category: Biology More task