Biology

Biology, 18.07.2019 14:00, ryleeshea816

List the nitrogen bases that would form the complementary strand: ttctaccctacatagactcat

answer

Answers: 1

Show answers

Similar questions

Предмет

Biology, 19.07.2019 00:20, kingoc321

Plz will also give brainliest 1.what is dna? why is it important to every living thing? 2.what two substances make the backbone of the dna molecule? 3.are the backbones of the dna molecule identical in all living things? 4.are the base pairs always the same? 5.if there were five guanine bases in one strand of your model of dna, how many cytosine bases would there be in the complementary strand? 6.if there were 10 bases of thymine in one strand of your model of dna, how many adenine bases would there be in the complementary strand? 7.if the dna molecule is so similar among all living things (the pairings are always the same and that there are only six components that make up dna), why is there so much diversity of life?

Answers: 1

Предмет

Biology, 26.07.2019 02:30, chelsea73

Will give brainliest 4. are the base pairs always the same? 5. if there were five guanine bases in one strand of your model of dna, how many cytosine bases would there be in the complementary strand? 6. if there were 10 bases of thymine in one strand of your model of dna, how many adenine bases would there be in the complementary strand? 7. if the dna molecule is so similar among all living things (the pairings are always the same and that there are only six components that make up dna), why is there so much diversity of life?

Answers: 1

Предмет

Biology, 17.09.2019 21:00, ethangeibel007

Adna molecule consists of two polynucleotide strands that form a double helix. the strands are held together by hydrogen bonds between the nitrogen‑containing bases. one strand is complementary to the other strand, which means that a base on one strand is paired with a base on the opposite strand. the nucleotide bases in dna are adenine (a), cytosine (c), guanine (g), and thymine (t). choose the dna sequence complementary to gact (a) agtc (b) gact (c) tcag(d) ctga

Answers: 2

Предмет

Biology, 19.10.2019 18:30, yurlgurllmay

The following strand of dna is undergoing replication: cgttacat. what is the sequence of bases that will form as the complementary strand?

Answers: 1

Do you know the correct answer?

List the nitrogen bases that would form the complementary strand: ttctaccctacatagactcat...

Questions in other subjects:

Konu

Mathematics, 25.08.2021 01:20

Find (fog)(x) and (gof)(x). f(x) = 7x-7, g(x) = 4 - 2xpleaseee helppp...

Konu

English, 25.08.2021 01:20

-Ready Ask Questions About Stories - Quiz Level C KD) Which detail helps answer the question about Rica's problem? Add the detaliate the chart. Question S...

Konu

Mathematics, 25.08.2021 01:20

What is the prime factorization of 1,100?...

Konu

Physics, 25.08.2021 01:20

Consider a very long electrical conductor of 10mm diameter, it is placed concentrically inside a cooled cylindrical tube of 50mm in diameter. The conductor is dissipating heat of 6...

Konu

Business, 25.08.2021 01:20

A newly independent Eastern European nation wants to adopt a floating exchange rate system in order to restore monetary control to its government. Using the monetary autonomy argum...

Konu

Mathematics, 25.08.2021 01:20

Which is small 1.2 or 1.7...

Konu

Mathematics, 25.08.2021 01:20

5/8x - 11/2 = 3/4 what does the x equal ?...

Konu

English, 25.08.2021 01:20

To help you. Dwer forutn introduction Useful La conclusion faith Some peo The quest Local per The City Times Howeve I believe

Konu

History, 25.08.2021 01:20

What were the most valid arguments used to promote English colonization in the sixteenth and seventeenth centuries...

Konu

English, 25.08.2021 01:20

Help pleaseI need to put the question on another page...

Other tasks in the category: Biology More task