Biology
Biology, 09.10.2019 15:30, harleyy6134

Which of the following organisms is not found in savannas? a. cheetah b. pangolin c. prairie chickens d. hyena

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 21.06.2019 17:00, warreliz
Why are adults bigger than they were as children biology
Answers: 2
image
Biology, 22.06.2019 03:50, randall10
How does human environment effect the biosphere
Answers: 2
image
Biology, 22.06.2019 08:00, kajjumiaialome
Which nucleotide component contains nitrogen
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Which of the following organisms is not found in savannas? a. cheetah b. pangolin c. prairie chicke...

Questions in other subjects:

Konu
English, 25.11.2021 19:20
Konu
Mathematics, 25.11.2021 19:20